SeqAn3 3.3.0-rc.1
The Modern C++ library for sequence analysis.
CIGAR Conversion

The CIGAR Conversion submodule contains utility functions to convert a CIGAR to an alignment or vice versa. More...

+ Collaboration diagram for CIGAR Conversion:

Classes

struct  seqan3::cigar_clipped_bases
 Helper struct to specialise soft and hard clipping when using seqan3::cigar_from_alignment. More...
 

Functions

template<typename reference_type , typename sequence_type >
auto seqan3::alignment_from_cigar (std::vector< cigar > const &cigar_vector, reference_type const &reference, uint32_t const zero_based_reference_start_position, sequence_type const &query)
 Construct an alignment from a cigar string and the corresponding sequnces. More...
 
template<typename alignment_type >
auto seqan3::cigar_from_alignment (alignment_type const &alignment, cigar_clipped_bases const &clipped_bases={}, bool const extended_cigar=false)
 Creates a cigar string (SAM format) given a seqan3::detail::pairwise_alignment represented by two seqan3::aligned_sequences. More...
 

Detailed Description

The CIGAR Conversion submodule contains utility functions to convert a CIGAR to an alignment or vice versa.

Function Documentation

◆ alignment_from_cigar()

template<typename reference_type , typename sequence_type >
auto seqan3::alignment_from_cigar ( std::vector< cigar > const &  cigar_vector,
reference_type const &  reference,
uint32_t const  zero_based_reference_start_position,
sequence_type const &  query 
)
inline

Construct an alignment from a cigar string and the corresponding sequnces.

Template Parameters
reference_typeThe type of the reference sequence for a SAM record.
sequence_typeThe type of the read sequence for a SAM record.
Parameters
[in]cigar_vectorThe cigar information to convert to an alignment.
[in]referenceThe reference sequence to which the query was aligned to, the alignment being represented by cigar_vector.
[in]zero_based_reference_start_positionThe start position of the alignment in the reference sequence. The position is zero based. When using our seqan3::sam_file_input, note that the seqan3::sam_file_input::record_type::reference_position() is always zero based.
[in]queryThe query or read sequence of the alignment represented by cigar_vector.
Returns
An alignment represented by a std::tuple of size 2 holding 2 seqan3::gap_decorators. At position 0 is the aligned reference sequence and at position 1 the aligned read sequence.

Quick background on the CIGAR string

The CIGAR string is a compact representation of an aligned read against a reference and was introduced by the SAM format. The SAM format stores the result of mapping short/long read sequences from a sequencing experiment (e.g. Illumina/Nanopore) against a reference (e.g. hg38).

Conversion to an alignment

You can reconstruct a full alignment from a CIGAR string, if you have the respective sequences at hand:

using namespace seqan3::literals;
int main()
{
// CIGAR string = 2M1D1M
std::vector<seqan3::cigar> cigar_vector{{2, 'M'_cigar_operation},
{1, 'D'_cigar_operation},
{2, 'M'_cigar_operation}};
uint32_t reference_start_position{0}; // read is aligned at the start of the reference
seqan3::dna5_vector reference = "ACTGATCGAGAGGATCTAGAGGAGATCGTAGGAC"_dna5;
seqan3::dna5_vector query = "ACGA"_dna5;
auto alignment = alignment_from_cigar(cigar_vector, reference, reference_start_position, query);
seqan3::debug_stream << alignment << std::endl; // prints (ACTGA,AC-GA)
}
Provides the function seqan3::alignment_from_cigar.
Provides the seqan3::cigar alphabet.
Provides seqan3::debug_stream and related types.
Provides seqan3::dna5, container aliases and string literals.
T endl(T... args)
auto alignment_from_cigar(std::vector< cigar > const &cigar_vector, reference_type const &reference, uint32_t const zero_based_reference_start_position, sequence_type const &query)
Construct an alignment from a cigar string and the corresponding sequnces.
Definition: alignment_from_cigar.hpp:83
debug_stream_type debug_stream
A global instance of seqan3::debug_stream_type.
Definition: debug_stream.hpp:37
@ alignment
The (pairwise) alignment stored in an object that models seqan3::detail::pairwise_alignment.
The SeqAn namespace for literals.

Quick explanation of the alignment representation

In seqan3, an alignment is represented by a std::tuple of size 2 that hold to seqan3::aligned_sequences.

The data structure that we use most often to model seqan3::aligned_sequence is the seqan3::gap_decorator. It is a lightweight data structure that only holds a view on the sequence (no copy is made) and on top can hold seqan3::gaps.

In the above example the read sequence ACGT is aligned to the reference with one gap: AC-GA wehre - represents a gap. In the CIGAR string the gap in the query/read is represented by 1D.

The full alignment consist of two aligned sequences (read and reference). In the above example, the alignment

position 01234
reference ACTGA
read AC-GA

is represented by a tuple of the aligned reference at the first position (std::get<0>) and the aligned read at the second position (std::get<1>): (ACTGA,AC-GA).

IO Example

A more realistic example is that you get the information directly from a SAM file:

using namespace seqan3::literals;
auto sam_file_raw = R"(@HD VN:1.6
@SQ SN:ref LN:34
read1 41 ref 1 61 1S1M1D1M1I ref 10 300 ACGT !##$ AS:i:2 NM:i:7
read2 42 ref 2 62 1H7M1D1M1S2H ref 10 300 AGGCTGNAG !##$&'()* xy:B:S,3,4,5
read3 43 ref 3 63 1S1M1P1M1I1M1I1D1M1S ref 10 300 GGAGTATA !!*+,-./
)";
int main()
{
// the reference sequence might be read from a different file
seqan3::dna5_vector reference = "ACTGATCGAGAGGATCTAGAGGAGATCGTAGGAC"_dna5;
// you will probably read it from a file, e.g. like this:
// seqan3::sam_file_input fin{"test.sam"};
for (auto && rec : fin)
{
auto alignment =
alignment_from_cigar(rec.cigar_sequence(), reference, rec.reference_position().value(), rec.sequence());
}
// prints:
// (ACT-,C-GT)
// (CTGATCGAG,AGGCTGN-A)
// (T-G-A-TC,G-AGTA-T)
}
The SAM format (tag).
Definition: format_sam.hpp:117
A class for reading alignment files, e.g. SAM, BAM, BLAST ...
Definition: input.hpp:256
Meta-header for the IO / SAM File submodule .
See also
seqan3::sam_file_input
seqan3::cigar

◆ cigar_from_alignment()

template<typename alignment_type >
auto seqan3::cigar_from_alignment ( alignment_type const &  alignment,
cigar_clipped_bases const &  clipped_bases = {},
bool const  extended_cigar = false 
)
inline

Creates a cigar string (SAM format) given a seqan3::detail::pairwise_alignment represented by two seqan3::aligned_sequences.

Template Parameters
alignment_typeMust model seqan3::detail::pairwise_alignment.
Parameters
alignmentThe alignment, represented by a pair of aligned sequences, to be transformed into cigar vector based on the second (query) sequence.
clipped_basesGives information on whether the query sequence was cropped (hard clipping) before the alignment or whether part of the query sequence does not take part (soft clipping) in the alignment.
extended_cigarWhether to print the extended cigar alphabet or not. See seqan3::cigar::operation.
Returns
A std::vector<seqan3::cigar> representing the alignment.
Note
The resulting cigar_vector is based on the query sequence, which is the second sequence in the alignment pair.

Example:

Given the following alignment, reference sequence on top and the query sequence at the bottom:

ATGG--CGTAGAGC
|||X |||X| |
ATGCCCCGTTG--C

In this case, the function seqan3::cigar_from_alignment will return the following cigar vector:

[('M',4),('I',2),('M',5),('D',2),('M',1)]

The extended cigar string would look like this:

[('=',3)('X',1)('I',2)('=',3)('X',1)('=',1)('D',2)('=',1)]
int main()
{
using namespace seqan3::literals;
seqan3::dna5_vector reference = "ATGGCGTAGAGCTTCCCCCCCCCCCCCCCCC"_dna5;
seqan3::dna5_vector read = "ATGCCCCGTTGCTT"_dna5; // length 14
// we align the full query against the first 14 bases in the reference
seqan3::gap_decorator aligned_reference{reference | seqan3::views::slice(0, 14)};
seqan3::gap_decorator aligned_read{read};
// insert gaps (as in the alignment above)
seqan3::insert_gap(aligned_reference, aligned_reference.begin() + 4, 2);
seqan3::insert_gap(aligned_read, aligned_read.begin() + 11, 2);
auto cigar_sequence = seqan3::cigar_from_alignment(std::tie(aligned_reference, aligned_read));
seqan3::debug_stream << cigar_sequence << '\n'; // prints [4M,2I,5M,2D,3M]
}
Includes the aligned_sequence and the related insert_gap and erase_gap functions to enable stl contai...
Provides the function seqan3::cigar_from_alignment and a helper struct seqan3::cigar_clipped_bases.
A gap decorator allows the annotation of sequences with gap symbols while leaving the underlying sequ...
Definition: gap_decorator.hpp:81
Provides seqan3::gap_decorator.
Provides seqan3::gapped.
auto cigar_from_alignment(alignment_type const &alignment, cigar_clipped_bases const &clipped_bases={}, bool const extended_cigar=false)
Creates a cigar string (SAM format) given a seqan3::detail::pairwise_alignment represented by two seq...
Definition: cigar_from_alignment.hpp:115
constexpr auto slice
A view adaptor that returns a half-open interval on the underlying range.
Definition: slice.hpp:178
Provides seqan3::views::slice.
T tie(T... args)

Soft and Hard clipping

The terms soft and hard clipping were introduced by the SAM specifications. A SAM file is only storing a semi alignment represented by the CIGAR string. The semi alignment of a query sequence is most often the result of a read mapping.

Hard clipping

Before aligning a query or read to the reference, some tools crop the query sequence because the quality is bad at one end (e.g. illumina read sometime feature a bad sequence quality towards the end of the read).

To inform the user of a SAM file that query sequences were altered, hard-clipping information is appended to the CIGAR string. E.g. 100M50H indicates that a read of former length 150 has been cropped at the right end by 50 bases. The sequence in the SAM file will thus only be 100 bases long.

Soft clipping

In constrast to hard clipping, a soft clipping indicated that the read was that altered/cropped but the respective bases still do not particiapte in the alignment. E.g. 100M50S indicates that a read of length 150 has been aligned without the rightmost 50 bases The sequence in the SAM file will thus be 150 bases long.

Adding soft and hard clipping with seqan3::cigar_from_alignment

You can add the respective clipping information by passing an instance of seqan3::cigar_clipped_bases:

int main()
{
using namespace seqan3::literals;
seqan3::dna5_vector reference = "ATGGCGTAGAGCTTCCCCCCCCCCCCCCCCC"_dna5;
seqan3::dna5_vector read = "ATGCCCCGTTGCTT"_dna5; // length 14
// Let's say, we want to ignore the last 2 bases of the query because the quality is low
// we thus only align the first 12 bases: (the last to will be soft-clipped bases in the CIGAR string)
seqan3::gap_decorator aligned_reference{reference | seqan3::views::slice(0, 12)};
seqan3::gap_decorator aligned_query{read | seqan3::views::slice(0, 12)};
// insert gaps
seqan3::insert_gap(aligned_reference, aligned_reference.begin() + 4, 2);
seqan3::insert_gap(aligned_query, aligned_query.begin() + 11, 2);
auto cigar_sequence =
seqan3::cigar_from_alignment(std::tie(aligned_reference, aligned_query),
{.hard_front = 1, .hard_back = 0, .soft_front = 0, .soft_back = 2});
seqan3::debug_stream << cigar_sequence << '\n'; // prints [1H,4M,2I,5M,2D,1M,2S]
}
See also
seqan3::cigar_clipped_bases
seqan3::sam_file_output
seqan3::cigar
seqan3::aligned_sequence